summaryrefslogtreecommitdiff
path: root/libs/algorithm/test/search_test1.cpp
diff options
context:
space:
mode:
authorLorry Tar Creator <lorry-tar-importer@baserock.org>2013-06-25 22:59:01 +0000
committer <>2013-09-27 11:49:28 +0000
commit8c4528713d907ee2cfd3bfcbbad272c749867f84 (patch)
treec09e2ce80f47b90c85cc720f5139089ad9c8cfff /libs/algorithm/test/search_test1.cpp
downloadboost-tarball-baserock/morph.tar.gz
Imported from /home/lorry/working-area/delta_boost-tarball/boost_1_54_0.tar.bz2.boost_1_54_0baserock/morph
Diffstat (limited to 'libs/algorithm/test/search_test1.cpp')
-rw-r--r--libs/algorithm/test/search_test1.cpp272
1 files changed, 272 insertions, 0 deletions
diff --git a/libs/algorithm/test/search_test1.cpp b/libs/algorithm/test/search_test1.cpp
new file mode 100644
index 000000000..7c49a3a82
--- /dev/null
+++ b/libs/algorithm/test/search_test1.cpp
@@ -0,0 +1,272 @@
+/*
+ Copyright (c) Marshall Clow 2010-2012.
+
+ Distributed under the Boost Software License, Version 1.0. (See accompanying
+ file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+ For more information, see http://www.boost.org
+*/
+
+#include <boost/algorithm/searching/boyer_moore.hpp>
+#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
+#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
+
+#define BOOST_TEST_MAIN
+#include <boost/test/unit_test.hpp>
+
+#include <iostream>
+#include <string>
+#include <vector>
+
+
+namespace ba = boost::algorithm;
+
+template <typename Iter>
+std::string make_str ( Iter first, std::size_t len ) {
+ std::string retVal ( len + 2, '\'' );
+ std::copy ( first, first+len, retVal.begin () + 1);
+ return retVal;
+ }
+
+namespace {
+
+// Check using iterators
+ template<typename Container>
+ void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
+ typedef typename Container::const_iterator iter_type;
+ typedef std::string::const_iterator pattern_type;
+
+ iter_type hBeg = haystack.begin ();
+ iter_type hEnd = haystack.end ();
+ pattern_type nBeg = needle.begin ();
+ pattern_type nEnd = needle.end ();
+
+ iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
+ iter_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
+ iter_type it1r = ba::boyer_moore_search (haystack, nBeg, nEnd);
+ iter_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
+ iter_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
+ const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
+
+ std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
+ try {
+ if ( it0 != it1 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between std::search and boyer-moore search" ));
+ }
+
+ if ( it1 != it1r ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between iterator and range boyer_moore search" ));
+ }
+
+ if ( it1 != it2 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
+ }
+
+ if ( it1 != it3 )
+ throw std::runtime_error (
+ std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
+
+ }
+
+ catch ( ... ) {
+ std::cout << "Searching for: " << needle << std::endl;
+ std::cout << "Expected: " << expected << "\n";
+ std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
+ std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
+ std::cout << " bm(r): " << std::distance ( hBeg, it1r ) << "\n";
+ std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
+ std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
+ std::cout << std::flush;
+ throw ;
+ }
+
+ BOOST_CHECK_EQUAL ( dist, expected );
+ }
+
+// Check using pointers
+// We're assuming that the container implements contiguous storage here.
+ template<typename Container>
+ void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
+ typedef const typename Container::value_type *ptr_type;
+ ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
+ ptr_type hEnd = hBeg + haystack.size ();
+ ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
+ ptr_type nEnd = nBeg + needle.size ();
+
+ ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
+ ptr_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
+ ptr_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
+ ptr_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
+ const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
+
+ std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
+ try {
+ if ( it0 != it1 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between std::search and boyer-moore search" ));
+ }
+
+ if ( it1 != it2 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
+ }
+
+ if ( it1 != it3 )
+ throw std::runtime_error (
+ std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
+
+ }
+
+ catch ( ... ) {
+ std::cout << "Searching for: " << needle << std::endl;
+ std::cout << "Expected: " << expected << "\n";
+ std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
+ std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
+ std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
+ std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
+ std::cout << std::flush;
+ throw ;
+ }
+
+ BOOST_CHECK_EQUAL ( dist, expected );
+ }
+
+// Check using objects
+ template<typename Container>
+ void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
+ typedef typename Container::const_iterator iter_type;
+ typedef std::string::const_iterator pattern_type;
+
+ iter_type hBeg = haystack.begin ();
+ iter_type hEnd = haystack.end ();
+ pattern_type nBeg = needle.begin ();
+ pattern_type nEnd = needle.end ();
+
+ ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle );
+ ba::boyer_moore<pattern_type> bm ( nBeg, nEnd );
+ ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd );
+ ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd );
+
+ iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
+ iter_type it1 = bm (hBeg, hEnd);
+ iter_type it1r = bm (haystack);
+ iter_type rt1 = bm_r (hBeg, hEnd);
+ iter_type rt1r = bm_r (haystack);
+ iter_type it2 = bmh (hBeg, hEnd);
+ iter_type it3 = kmp (hBeg, hEnd);
+ const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
+
+ std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
+ try {
+ if ( it0 != it1 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between std::search and boyer-moore search" ));
+ }
+
+ if ( it1 != it1r ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
+ }
+
+ if ( it1 != rt1 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
+ }
+
+ if ( rt1 != rt1r ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
+ }
+
+ if ( it1 != it2 ) {
+ throw std::runtime_error (
+ std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
+ }
+
+ if ( it1 != it3 )
+ throw std::runtime_error (
+ std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
+
+ }
+
+ catch ( ... ) {
+ std::cout << "Searching for: " << needle << std::endl;
+ std::cout << "Expected: " << expected << "\n";
+ std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
+ std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
+ std::cout << " bm(r1): " << std::distance ( hBeg, it1r ) << "\n";
+ std::cout << " bm(r2): " << std::distance ( hBeg, rt1 ) << "\n";
+ std::cout << " bm(r3): " << std::distance ( hBeg, rt1r ) << "\n";
+ std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
+ std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
+ std::cout << std::flush;
+ throw ;
+ }
+
+ BOOST_CHECK_EQUAL ( dist, expected );
+ }
+
+
+ template<typename Container>
+ void check_one ( const Container &haystack, const std::string &needle, int expected ) {
+ check_one_iter ( haystack, needle, expected );
+ check_one_pointer ( haystack, needle, expected );
+ check_one_object ( haystack, needle, expected );
+ }
+ }
+
+
+BOOST_AUTO_TEST_CASE( test_main )
+{
+ std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
+ std::string needle1 ( "ANPANMAN" );
+ std::string needle2 ( "MAN THE" );
+ std::string needle3 ( "WE\220ER" );
+ std::string needle4 ( "NOW " ); // At the beginning
+ std::string needle5 ( "NEND" ); // At the end
+ std::string needle6 ( "NOT FOUND" ); // Nowhere
+ std::string needle7 ( "NOT FO\340ND" ); // Nowhere
+
+ std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
+ std::string needle11 ( "ABCDABD" );
+
+ std::string haystack3 ( "abra abracad abracadabra" );
+ std::string needle12 ( "abracadabra" );
+
+ std::string needle13 ( "" );
+ std::string haystack4 ( "" );
+
+ check_one ( haystack1, needle1, 26 );
+ check_one ( haystack1, needle2, 18 );
+ check_one ( haystack1, needle3, 9 );
+ check_one ( haystack1, needle4, 0 );
+ check_one ( haystack1, needle5, 33 );
+ check_one ( haystack1, needle6, -1 );
+ check_one ( haystack1, needle7, -1 );
+
+ check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus
+ check_one ( haystack1, haystack1, 0 ); // find something in itself
+ check_one ( haystack2, haystack2, 0 ); // find something in itself
+
+ check_one ( haystack2, needle11, 15 );
+ check_one ( haystack3, needle12, 13 );
+
+ check_one ( haystack1, needle13, 0 ); // find the empty string
+ check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack
+
+// Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
+// that triggered it.
+
+ const std::string mikhail_pattern =
+"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
+"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
+"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
+"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
+;
+ const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
+
+ check_one ( mikhail_corpus, mikhail_pattern, 8 );
+ }